ID: 1074309947_1074309954

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1074309947 1074309954
Species Human (GRCh38) Human (GRCh38)
Location 10:112313511-112313533 10:112313551-112313573
Sequence CCCTGGGATTGTGGTCAGTGCTG CACCAGGCATGTATGAGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!