ID: 1074317841_1074317850

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1074317841 1074317850
Species Human (GRCh38) Human (GRCh38)
Location 10:112375470-112375492 10:112375521-112375543
Sequence CCAGGATCATGCTGAACTTCCTG GAAAGTGCTGCTTCATTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 193} {0: 1, 1: 0, 2: 2, 3: 14, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!