ID: 1074329226_1074329237

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1074329226 1074329237
Species Human (GRCh38) Human (GRCh38)
Location 10:112487372-112487394 10:112487422-112487444
Sequence CCTCAGCCTCCCAAAGTGCTGGG CCTAATCTTGCATTTTTGAGAGG
Strand - +
Off-target summary {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!