ID: 1074332940_1074332942

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1074332940 1074332942
Species Human (GRCh38) Human (GRCh38)
Location 10:112537808-112537830 10:112537829-112537851
Sequence CCTGTTTTAAAATTTCTATCTGC GCAAGAATCAAAGGAGCAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 29, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!