ID: 1074343406_1074343409

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1074343406 1074343409
Species Human (GRCh38) Human (GRCh38)
Location 10:112656607-112656629 10:112656625-112656647
Sequence CCTTGATCTGCCTCGGCCTCCCA TCCCAAAGTGCTGAGATTATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 116, 4: 665} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!