ID: 1074382568_1074382574

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1074382568 1074382574
Species Human (GRCh38) Human (GRCh38)
Location 10:112992401-112992423 10:112992427-112992449
Sequence CCTTTGTTGGAGCTGGAGGTGAG CTGTGGGCGTTGGGATTCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!