ID: 1074434295_1074434299

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1074434295 1074434299
Species Human (GRCh38) Human (GRCh38)
Location 10:113420824-113420846 10:113420843-113420865
Sequence CCCTTCCCTAACTATCAGAGCTT GCTTTTCTCTCCCATGACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!