ID: 1074434296_1074434306

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1074434296 1074434306
Species Human (GRCh38) Human (GRCh38)
Location 10:113420825-113420847 10:113420876-113420898
Sequence CCTTCCCTAACTATCAGAGCTTT GGCACTTGGAATGCACCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143} {0: 1, 1: 0, 2: 2, 3: 14, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!