ID: 1074451094_1074451095

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1074451094 1074451095
Species Human (GRCh38) Human (GRCh38)
Location 10:113560178-113560200 10:113560208-113560230
Sequence CCTGAGCTTCAGGTGAAAGCAAA TGAACCTGCCAGTCTTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 231} {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!