ID: 1074455033_1074455048

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1074455033 1074455048
Species Human (GRCh38) Human (GRCh38)
Location 10:113589121-113589143 10:113589163-113589185
Sequence CCACCCCCACTCCCGGCCCCGGT AAGCACAGGGAGCATTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 149, 4: 3360} {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!