ID: 1074455045_1074455048

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1074455045 1074455048
Species Human (GRCh38) Human (GRCh38)
Location 10:113589146-113589168 10:113589163-113589185
Sequence CCACAGGACACGCTAAGAAGCAC AAGCACAGGGAGCATTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100} {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!