ID: 1074457079_1074457086

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1074457079 1074457086
Species Human (GRCh38) Human (GRCh38)
Location 10:113604547-113604569 10:113604560-113604582
Sequence CCCGGGTTTGGTGAAAGGAGAAA AAAGGAGAAAGGCTGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 33, 4: 330} {0: 1, 1: 0, 2: 10, 3: 105, 4: 989}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!