ID: 1074489026_1074489030

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1074489026 1074489030
Species Human (GRCh38) Human (GRCh38)
Location 10:113922231-113922253 10:113922248-113922270
Sequence CCTTGCACCTTGCTGTTACAAGT ACAAGTTGTAGGATACCCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!