ID: 1074530876_1074530887

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1074530876 1074530887
Species Human (GRCh38) Human (GRCh38)
Location 10:114297837-114297859 10:114297882-114297904
Sequence CCTGGCTCCTCCTGTTAACCCTG ACACCGTGAAATGATGCCTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!