ID: 1074536428_1074536442

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1074536428 1074536442
Species Human (GRCh38) Human (GRCh38)
Location 10:114331580-114331602 10:114331621-114331643
Sequence CCCCAGACCCATCACCCTCAGCA CAAGCAAATCACCTGTAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 81, 4: 1383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!