ID: 1074538456_1074538461

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1074538456 1074538461
Species Human (GRCh38) Human (GRCh38)
Location 10:114345607-114345629 10:114345622-114345644
Sequence CCCAATTTGGCCACATCCCTGAT TCCCTGATGAGTAGCGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!