ID: 1074550092_1074550096

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1074550092 1074550096
Species Human (GRCh38) Human (GRCh38)
Location 10:114434717-114434739 10:114434753-114434775
Sequence CCTCATCTAACTCACGTCGGGAA TCATATGCACGCACGTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 43} {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!