ID: 1074573579_1074573585

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1074573579 1074573585
Species Human (GRCh38) Human (GRCh38)
Location 10:114647537-114647559 10:114647575-114647597
Sequence CCTTACAAAATGATCCAGGTCAT AGCTGGCTGAGCGCTAGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!