ID: 1074614223_1074614232

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1074614223 1074614232
Species Human (GRCh38) Human (GRCh38)
Location 10:115050556-115050578 10:115050593-115050615
Sequence CCAACCAGAGCGACTCCATCTTG AAAACAGGGCTGAGACCTACTGG
Strand - +
Off-target summary {0: 4, 1: 4, 2: 15, 3: 10, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!