ID: 1074615915_1074615919

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1074615915 1074615919
Species Human (GRCh38) Human (GRCh38)
Location 10:115067973-115067995 10:115068002-115068024
Sequence CCTAAGCTTGGTAAAGATCAGTC GGGGCTTGACTAGAAAACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!