ID: 1074753723_1074753735

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1074753723 1074753735
Species Human (GRCh38) Human (GRCh38)
Location 10:116609696-116609718 10:116609735-116609757
Sequence CCCTGGGTCGAGGCGGCCTCGCG GCGGCGCGGAGGCGGGGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 15, 3: 128, 4: 912}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!