ID: 1074756505_1074756516

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1074756505 1074756516
Species Human (GRCh38) Human (GRCh38)
Location 10:116627804-116627826 10:116627829-116627851
Sequence CCACAGCCTGGGCGCGCACACGG GCGGAGGCGGGCAGGAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 196} {0: 2, 1: 0, 2: 7, 3: 70, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!