ID: 1074759305_1074759310

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1074759305 1074759310
Species Human (GRCh38) Human (GRCh38)
Location 10:116654531-116654553 10:116654548-116654570
Sequence CCCTTGAGGTGAAGCACCAGCTG CAGCTGCTTTAAGGGAACCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 39, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!