ID: 1074759410_1074759412

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1074759410 1074759412
Species Human (GRCh38) Human (GRCh38)
Location 10:116655096-116655118 10:116655111-116655133
Sequence CCAGGAATGAGTCCTGGTGCTCA GGTGCTCAACAACCCCATGCAGG
Strand - +
Off-target summary {0: 4, 1: 31, 2: 64, 3: 93, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!