ID: 1074829981_1074829992

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1074829981 1074829992
Species Human (GRCh38) Human (GRCh38)
Location 10:117241304-117241326 10:117241333-117241355
Sequence CCAGAGCTACGCGGGCGGGGCTG CCCCGGGGCAGCCGGGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114} {0: 1, 1: 0, 2: 5, 3: 40, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!