ID: 1074831735_1074831738

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1074831735 1074831738
Species Human (GRCh38) Human (GRCh38)
Location 10:117254395-117254417 10:117254428-117254450
Sequence CCCTGTGTAGGGATGGGCATGCT TACACAGATGATGAAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 138} {0: 1, 1: 0, 2: 2, 3: 41, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!