ID: 1074839415_1074839418

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1074839415 1074839418
Species Human (GRCh38) Human (GRCh38)
Location 10:117334224-117334246 10:117334239-117334261
Sequence CCTGTAATGTTGGGCTTCATGCC TTCATGCCCAGCACTTTGGGAGG
Strand - +
Off-target summary No data {0: 3, 1: 41, 2: 253, 3: 12103, 4: 345861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!