ID: 1074843128_1074843141

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1074843128 1074843141
Species Human (GRCh38) Human (GRCh38)
Location 10:117374897-117374919 10:117374947-117374969
Sequence CCCGCAACTCCCGGAACAGGAAT GTCTCCCGCGTCGGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 94} {0: 1, 1: 0, 2: 2, 3: 15, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!