ID: 1074855021_1074855030

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1074855021 1074855030
Species Human (GRCh38) Human (GRCh38)
Location 10:117467099-117467121 10:117467134-117467156
Sequence CCTGTCACTGTCACCATAGGGTT AGGGGAGCCTGGAGTGGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 9, 3: 143, 4: 1171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!