ID: 1074890878_1074890886 |
View in Genome Browser |
Spacer: 22 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1074890878 | 1074890886 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:117735706-117735728 | 10:117735751-117735773 |
| Sequence | CCTTAAATGGTGACTTGGAGCAG | CCAGCTGTAAATGGAGTTAACGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 18, 4: 150} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||