ID: 1074898369_1074898375

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1074898369 1074898375
Species Human (GRCh38) Human (GRCh38)
Location 10:117796094-117796116 10:117796144-117796166
Sequence CCTGTCTTCCCTCCAAGTGGGTC AAACTTAGCTAACCAGTTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!