ID: 1074910015_1074910026

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1074910015 1074910026
Species Human (GRCh38) Human (GRCh38)
Location 10:117899928-117899950 10:117899981-117900003
Sequence CCTTCCATCTTCCCATTCAATAG AGCCAAAATCTCATTGACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 349} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!