ID: 1074923692_1074923712

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1074923692 1074923712
Species Human (GRCh38) Human (GRCh38)
Location 10:118046440-118046462 10:118046485-118046507
Sequence CCACCTTCCCCAGGCCTGCGGGG ACCCGGGCGGAGGGCTGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 490} {0: 1, 1: 0, 2: 4, 3: 33, 4: 631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!