ID: 1075007268_1075007270

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1075007268 1075007270
Species Human (GRCh38) Human (GRCh38)
Location 10:118839968-118839990 10:118839994-118840016
Sequence CCCAGTTCTTCAGATGGAAGGCG GTTCGATACACGACCATGACAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 21, 3: 32, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!