ID: 1075052261_1075052265

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1075052261 1075052265
Species Human (GRCh38) Human (GRCh38)
Location 10:119191523-119191545 10:119191540-119191562
Sequence CCCTCATTGAAGAGGAGCCCCAG CCCCAGATTTGGCTCTCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!