ID: 1075088502_1075088507

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1075088502 1075088507
Species Human (GRCh38) Human (GRCh38)
Location 10:119429901-119429923 10:119429916-119429938
Sequence CCTGCTGGGCAGACTGAGATGCA GAGATGCACAGGTGTAGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 32, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!