ID: 1075129531_1075129545

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1075129531 1075129545
Species Human (GRCh38) Human (GRCh38)
Location 10:119726195-119726217 10:119726234-119726256
Sequence CCTCGACCGACTAGGACGCCCCG CGCCGCCTCCCTGGGCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20} {0: 1, 1: 0, 2: 2, 3: 26, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!