ID: 1075154920_1075154926

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1075154920 1075154926
Species Human (GRCh38) Human (GRCh38)
Location 10:119967334-119967356 10:119967349-119967371
Sequence CCATCTCTCCAAGGAGTTCTGGG GTTCTGGGCTGGGGTTTTTAAGG
Strand - +
Off-target summary No data {0: 10, 1: 39, 2: 64, 3: 110, 4: 588}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!