ID: 1075216303_1075216312

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1075216303 1075216312
Species Human (GRCh38) Human (GRCh38)
Location 10:120539231-120539253 10:120539247-120539269
Sequence CCCGTCCCCTAGAGCCACTGCTG ACTGCTGTTAGAGGCAGAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!