ID: 1075216307_1075216315

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1075216307 1075216315
Species Human (GRCh38) Human (GRCh38)
Location 10:120539238-120539260 10:120539265-120539287
Sequence CCTAGAGCCACTGCTGTTAGAGG AGGGGTCAGGATATGGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!