ID: 1075221856_1075221858

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1075221856 1075221858
Species Human (GRCh38) Human (GRCh38)
Location 10:120592054-120592076 10:120592075-120592097
Sequence CCATAATGAGAACGTTTATTCCT CTCAACCCCTGATTTTTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!