ID: 1075230262_1075230263

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1075230262 1075230263
Species Human (GRCh38) Human (GRCh38)
Location 10:120670452-120670474 10:120670497-120670519
Sequence CCATTTGTCTTCTAAAACAAATG AGCACTTAAAGTTTTACTCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!