ID: 1075324481_1075324484

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1075324481 1075324484
Species Human (GRCh38) Human (GRCh38)
Location 10:121519955-121519977 10:121519976-121519998
Sequence CCTTTAGATTCAGAAAGTCCTCA CACCTTGAGAACCTTGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 201} {0: 1, 1: 0, 2: 5, 3: 15, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!