ID: 1075333836_1075333844

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1075333836 1075333844
Species Human (GRCh38) Human (GRCh38)
Location 10:121595254-121595276 10:121595294-121595316
Sequence CCCCAAATCTCATCATAAAAACT CTGAGGACAAAAATGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 577} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!