ID: 1075345423_1075345427

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1075345423 1075345427
Species Human (GRCh38) Human (GRCh38)
Location 10:121678664-121678686 10:121678679-121678701
Sequence CCAGACACTCACACAGCCAGGCC GCCAGGCCTTGGGAACACCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!