ID: 1075413942_1075413947

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1075413942 1075413947
Species Human (GRCh38) Human (GRCh38)
Location 10:122248947-122248969 10:122248962-122248984
Sequence CCGCCTGGGGTTACACCTGCATC CCTGCATCCGAGAGTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 170} {0: 1, 1: 0, 2: 2, 3: 5, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!