ID: 1075461144_1075461155

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1075461144 1075461155
Species Human (GRCh38) Human (GRCh38)
Location 10:122617349-122617371 10:122617367-122617389
Sequence CCCTCTCTTTTCATGTCCCTGTG CTGTGGGTTGGGTGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 577} {0: 1, 1: 6, 2: 14, 3: 164, 4: 1368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!