ID: 1075519872_1075519877

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1075519872 1075519877
Species Human (GRCh38) Human (GRCh38)
Location 10:123136876-123136898 10:123136893-123136915
Sequence CCCAGGACTCGGCGTCCCTTCTC CTTCTCTGGCCCAGCCGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110} {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!