ID: 1075521934_1075521937

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1075521934 1075521937
Species Human (GRCh38) Human (GRCh38)
Location 10:123148412-123148434 10:123148435-123148457
Sequence CCGGCGGCCGGTGGCGTCTCCAG CTTCACCATCCAGTCCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 103} {0: 1, 1: 0, 2: 1, 3: 16, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!