ID: 1075521934_1075521948

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1075521934 1075521948
Species Human (GRCh38) Human (GRCh38)
Location 10:123148412-123148434 10:123148453-123148475
Sequence CCGGCGGCCGGTGGCGTCTCCAG CCTGGGCGGGGGCCCCTCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 103} {0: 1, 1: 0, 2: 4, 3: 32, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!